Input
Upload FASTA file: * Upload FASTA File

MODSIDE accepts DNA sequences in FASTA format with file extensions .fasta, .fa, and .txt. An example of input format is below.

>seq_0
TCTTTTTCCGTGCAAGATCAACGTTGAGCGCAAAATTGTTCGGAGACATTATCAACT
>seq_1
CAATTCTACCGCATGCCTAACAAAATGATTTCCGATTTTTTCAATCTAACTCCGTCA
>seq_2
GCCGGGCATACTCGGGATCTACCGTAGAATCCTATGCGTCACACATGAGGACAGGTT
>seq_3
CTGTCTAAACGATACAATCCTCGTTCCACCCACACCCATTCACCCGTCGGGCGAAAT


Or paste FASTA file: * Paste FASTA File

MODSIDE accepts DNA sequences in FASTA format. An example of input format is below.

>seq_0
TCTTTTTCCGTGCAAGATCAACGTTGAGCGCAAAATTGTTCGGAGACATTATCAACT
>seq_1
CAATTCTACCGCATGCCTAACAAAATGATTTCCGATTTTTTCAATCTAACTCCGTCA
>seq_2
GCCGGGCATACTCGGGATCTACCGTAGAATCCTATGCGTCACACATGAGGACAGGTT
>seq_3
CTGTCTAAACGATACAATCCTCGTTCCACCCACACCCATTCACCCGTCGGGCGAAAT


Organism: Organism

An organism can be selected from the dropdown for running Weeder but not required. If it is unspecified, Weeder assumes it is Homo Sapiens.


Motif Finders

* Motif Finders

At least two motif finders are required for running MODSIDE. The tools and their versions are below.

Tool Version
ChIPMunk v7
MEME 4.11.4_1
Weeder 1.4.2
XXmotif Current and only version (unspecified)


Similarity Detection and Output Format
Number of top significant motifs (between 1 and 50): * Number of Top Significant Motifs

This is a cutoff for number of top global significant motifs as well as number of top global and local significant motifs to be generated in the results.
It is currently limited to ≤ 50. The default value is set to 5.


Number of best matches (between 1 and 50): * Number of Best Matches

It is the number of motifs that are most similar to motif i (i from 1 to m) in a combined motif list M in MOTIFSIM. It is used for selecting the number of most similar motifs to motif i and report them in MOTIFSIM's results.
The best matched motifs are listed in the order of similarity with the most similar one is on the top of the list.
The number of best matches is currently limited to ≤ 50. The default value is set to 5.


Cutoff (in percentage) for similarity ( ≥ ): * Cutoff for Similarity

Currently, the cutoff values are ≥ 50%, ≥ 60%, ≥ 70%, ≥ 75%, ≥ 80%, ≥ 85%, and ≥ 90%.
A value ≥ 75% indicates a match of 75% or greater between two motifs. We suggest to use a cutoff ≥ 75% as this value shows a good threshold in our case studies.

If a higher cutoff value is used, fewer similar motifs are reported in the results. However, these motifs are more similar to the motif being compared.


Databse match: Database Match

Similar motifs in a reference database can be obtained for the global significant motifs, global and local significant motifs, as well as for every motif in the combined list M in MOTIFSIM.
Currently, the pipeline supports Jaspar 2016, Transfac (public version), and UniPROBE databases.


Motif tree: Yes No * Motif Tree

Motif trees can be generated for the global significant motifs as well as for the entire combined motif list M. The tree is built by using hclust function in R. This function implemented the hierarchical clustering algorithm.

MOTIFSIM generates the distance matrix for building the tree. This matrix contains the best similarity scores between motifs.


Combine similar motifs: Yes No * Combine Similar Motifs

Similar motifs discovered in the results can be combined into new motifs. Two similar motifs can be combined into a new motif if the new motif is within the similarity threshold with both of its parents.


Output file type: Global Significant Motifs Only All * Output File Type

It can be (1) Global Significant Motifs Only, or (2) All.
The former generates only the global significant motifs in the results.
The later generates all results and it requires longer time for processing large datasets.


Output file format: Text HTML PDF All * Output File Format

The results from MOTIFSIM can be generated in Text, HTML, PDF, and All three formats. HTML, PDF, and All formats require longer time for processing large datasets.


Use sample data

Users can run test on sample data. The Use Sample Data button fills the required fields with sample data and input parameters below and submit it. The result page appears when the submitted job is completed.

Sample data:

>seq_0
TCTTTTTCCGTGCAAGATCAACGTTGAGCGCAAAATTGTTCGGAGACATTATCAACTCATTCATAGATCCATTAAACTGGAAAACACTATTTGTTATTTTTTG
>seq_1
CAATTCTACCGCATGCCTAACAAAATGATTTCCGATTTTTTCAATCTAACTCCGTCATTTCTTATCTGAGTTTTCCTCCCCCACCGGCGGTCTTTCGTCCGTG
>seq_2
GCCGGGCATACTCGGGATCTACCGTAGAATCCTATGCGTCACACATGAGGACAGGTTACGAACCGTCGAAGGCTTCGCGGCGTGTGTGATTAGTATTGTTTTG
>seq_3
CTGTCTAAACGATACAATCCTCGTTCCACCCACACCCATTCACCCGTCGGGCGAAATCCACCCTCGCGGCCTCGTTTAGAATACCAGGCAACGGCACCAGCAA


Input parameters:

Parameter Value
Organism Homo sapiens
Motif Finder ChIPMunk and Weeder
Number of top significant motifs 3
Number of best matches 3
Cutoff for similarity 75%
Databse match No selection
Motif tree No
Combine similar motifs No
Output file type All
Output file format Text
Email address (optional): Email Address

Optional. If it is provided, users will be notified when a submitted job is completed and ready for viewing and downloading.

* Required field.

Supported by

The AWS Cloud Credits for Research Program

Last updated on 09/01/2018